View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16621_low_2 (Length: 256)
Name: NF16621_low_2
Description: NF16621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16621_low_2 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 14 - 238
Target Start/End: Complemental strand, 12214723 - 12214499
Alignment:
| Q |
14 |
ataatacttgtgtgcagaattctatggtggctaatttgattccacgtcgagtgacatttgaagataataatatgctaatcaagttaccactgtttgaata |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| | |
|
|
| T |
12214723 |
ataatacttgtgtgcagaattctatggtggctaatttgattccacgtcgagtgacatttgaagataataatatgctagtcaagttaccactttttgaaga |
12214624 |
T |
|
| Q |
114 |
gattaaggttgtagtttttgatttgaatggggatggtgctcctggtctggatggttttgatggctactttttccagacattcttggacattgttgcaaag |
213 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12214623 |
gattaaggttgcaatttttgatttgaatggggatggtgctcctggtctggatggttttgatggctactttttccagacattcttggacattgttgcaaag |
12214524 |
T |
|
| Q |
214 |
gatgcgagtcttttggttcaggaat |
238 |
Q |
| |
|
||||||| ||||||||||||||||| |
|
|
| T |
12214523 |
gatgcgattcttttggttcaggaat |
12214499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University