View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16622_high_19 (Length: 260)
Name: NF16622_high_19
Description: NF16622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16622_high_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 19 - 242
Target Start/End: Original strand, 40774024 - 40774247
Alignment:
| Q |
19 |
tatcatggcaacgtggaaagccaatgccagcggcagtgtcaatcctgttggtgttagatattctttaaccataaaaatgaatgtttatgaataagccatt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40774024 |
tatcatggcaacgtggaaagccaatgccagcggcagtgtcaatcctgttggtgttagatattctttaaccataaaaatgaatgtttatgcataagccatt |
40774123 |
T |
|
| Q |
119 |
agatatttacataaacaaatcatttcttatacaaataggatctacaacatgcttgattagaatcatttatatcaatacttatctgaaataatagttcgga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||| | ||| |
|
|
| T |
40774124 |
agatatttacataaacaaatcatttcttatactaatagaatctacaacatgcttgattagaatcatttatatcaatacttatctgaaatgatagattgga |
40774223 |
T |
|
| Q |
219 |
tttatgaaacacggatacagacac |
242 |
Q |
| |
|
| |||||||||||||||||||||| |
|
|
| T |
40774224 |
tctatgaaacacggatacagacac |
40774247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University