View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16622_high_5 (Length: 421)
Name: NF16622_high_5
Description: NF16622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16622_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 122; Significance: 2e-62; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 274 - 411
Target Start/End: Original strand, 37760276 - 37760413
Alignment:
| Q |
274 |
tatgcagttttatgtttgaaatttggaccgatcattacatgtattaagttagtatatttatttatcaaatcaacaagttgatggttaaaactcgaaaact |
373 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37760276 |
tatgcagttttatgtttgaaatttggactgatcattacatgtattaagttagtatgtttatttatcaaatcaacaagttgatggttaaaactcgaaaact |
37760375 |
T |
 |
| Q |
374 |
tgtatagttgatgatgtataggctacctttggagaatt |
411 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
37760376 |
tgtatagttgatgatgtataggttacctttgaagaatt |
37760413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 19 - 137
Target Start/End: Original strand, 37760015 - 37760135
Alignment:
| Q |
19 |
cacatcaatgccaactgactgcttaacaaattcctaaaatatttttagtgtttttaggtttgtaga--nnnnnnnnnagtaaagaagggtttgcagaatt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37760015 |
cacatcaatgccaactgactgcttaacaaattcataaaatatttttagtgtttttaggtttgtagatttttttctttagtaaagaagggtttgcagaatt |
37760114 |
T |
 |
| Q |
117 |
ttcatttctatattactctat |
137 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
37760115 |
ttcatttctatattactctat |
37760135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 197 - 234
Target Start/End: Original strand, 37760196 - 37760233
Alignment:
| Q |
197 |
gtctctaacactcgacaacaaaataatgtacctctttc |
234 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37760196 |
gtctctaacactcgacaacaaaataatgcacctctttc |
37760233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University