View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16622_low_26 (Length: 202)
Name: NF16622_low_26
Description: NF16622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16622_low_26 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 92; Significance: 7e-45; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 93 - 184
Target Start/End: Complemental strand, 33588841 - 33588750
Alignment:
| Q |
93 |
cgtgggaatgaatcttgtaattgtcaaggacccctcaagaaagacccatcttctttcataaccacatcgtagagtactttggaggacgtggt |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33588841 |
cgtgggaatgaatcttgtaattgtcaaggacccctcaagaaagacccatcttctttcataaccacatcgtagagtactttggaggacgtggt |
33588750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 10 - 72
Target Start/End: Complemental strand, 33588927 - 33588865
Alignment:
| Q |
10 |
tgagatgaatggaaaaggatgggagtagaaagaattttatggagagaatggttatgcatgtgg |
72 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33588927 |
tgagatgagtggaaaaggatgggagtagaaataattttatggagagaatggttatgcatgtgg |
33588865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University