View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16623_low_19 (Length: 293)
Name: NF16623_low_19
Description: NF16623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16623_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 268; Significance: 1e-150; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 268; E-Value: 1e-150
Query Start/End: Original strand, 1 - 276
Target Start/End: Original strand, 3598639 - 3598914
Alignment:
| Q |
1 |
gatatcattagcaggtaaatgggaggatgtactagatgcaaatgcgttacaggtgatccctctcaagggggcaatgacaaatgaggtatttgaaataaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3598639 |
gatatcattagcaggtaaatgggaggatgtactagatgcaaatgcgttacaggtgatccctctcaagggggcaatgacaaatgaggtatttgaaataaag |
3598738 |
T |
 |
| Q |
101 |
tggccagctacaactgaggaaacctcacgaaaagttcttgttaggatctacggggagggtgtggaaattttctttgatagggatgatgaaatacggacat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3598739 |
tggccagctacaactgaggaaacctcacgaaaagttcttgttaggatctacggggagggtgtggaaattttctttgatagggatgatgaaatacggacat |
3598838 |
T |
 |
| Q |
201 |
ttgagtacatgtcaaagaatggtcagggaccacgtctgcttggacgttttacaaatggacgtgttgaagagtttat |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3598839 |
ttgagtacatgtcaaagaatggtcagggaccacgtctactaggacgttttacaaatggacgtgttgaagagtttat |
3598914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University