View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16624_high_13 (Length: 313)
Name: NF16624_high_13
Description: NF16624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16624_high_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 193 - 295
Target Start/End: Original strand, 42524921 - 42525023
Alignment:
| Q |
193 |
gtgctggttcaggttctggttgtggaactattttggcttgctttttagttcgtctataaacaaaatccactaacttgttgccgtccatggtccccgtcac |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42524921 |
gtgctggttcaggttctggttgtggaactattttggcttgctttttagttcgtctataaacaaaatccactaacttgttgccgtccatggtccccgtcac |
42525020 |
T |
|
| Q |
293 |
aat |
295 |
Q |
| |
|
||| |
|
|
| T |
42525021 |
aat |
42525023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 13 - 88
Target Start/End: Original strand, 42524741 - 42524816
Alignment:
| Q |
13 |
gattatactagttatagtacaccatcctcttcatcatatcttcctcatcatgaactccattaatctcttccccatc |
88 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42524741 |
gattataatagttatagtacatcatcctcttcatcatatcttcctcatcatgaactccattaatctcttccccatc |
42524816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 196 - 271
Target Start/End: Complemental strand, 29282723 - 29282648
Alignment:
| Q |
196 |
ctggttcaggttctggttgtggaactattttggcttgctttttagttcgtctataaacaaaatccactaacttgtt |
271 |
Q |
| |
|
||||||||||||| |||| ||||||||||| ||||| ||||| |||| |||||| ||| ||||||||| |||||| |
|
|
| T |
29282723 |
ctggttcaggttcgggtttaggaactattttcgcttgttttttggttcttctatagacataatccactagcttgtt |
29282648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 196 - 271
Target Start/End: Original strand, 6470269 - 6470344
Alignment:
| Q |
196 |
ctggttcaggttctggttgtggaactattttggcttgctttttagttcgtctataaacaaaatccactaacttgtt |
271 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||| ||||| ||| | |||| ||| ||||||||| |||||| |
|
|
| T |
6470269 |
ctggttcaggttctggtttaggaactatttttgcttgttttttggtttttttatagacataatccactagcttgtt |
6470344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University