View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16624_high_18 (Length: 252)

Name: NF16624_high_18
Description: NF16624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16624_high_18
NF16624_high_18
[»] chr5 (3 HSPs)
chr5 (116-235)||(22369211-22369331)
chr5 (31-83)||(22369364-22369416)
chr5 (198-226)||(40798150-40798178)


Alignment Details
Target: chr5 (Bit Score: 85; Significance: 1e-40; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 116 - 235
Target Start/End: Complemental strand, 22369331 - 22369211
Alignment:
116 acagttattagttaattgctttctattatgtgaagtaagcgcacacatcttttgcacacttt-tnnnnnnnnttgtagtttctgattattgaatttttta 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||          ||||||||||||||||||||||||||||    
22369331 acagttattagttaattgctttctattatgtgaagtaagcgcacacatcttttgcacactttaaaaaaaaaattgtagtttctgattattgaatttttta 22369232  T
215 aaatctgcaagtttatgtttg 235  Q
    |||||||||||||||||||||    
22369231 aaatctgcaagtttatgtttg 22369211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 31 - 83
Target Start/End: Complemental strand, 22369416 - 22369364
Alignment:
31 agatatccttcatatcattttcaatatagtcaaaggtatcggttagtactcca 83  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||    
22369416 agatatccttcatatcattttcaatatagtcaaagatatcggttagtactcca 22369364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 198 - 226
Target Start/End: Original strand, 40798150 - 40798178
Alignment:
198 gattattgaattttttaaaatctgcaagt 226  Q
    |||||||||||||||||||||||||||||    
40798150 gattattgaattttttaaaatctgcaagt 40798178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University