View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16624_high_23 (Length: 209)
Name: NF16624_high_23
Description: NF16624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16624_high_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 20 - 192
Target Start/End: Complemental strand, 7423910 - 7423731
Alignment:
| Q |
20 |
tgagtcgtagcattttgccacataggcgtgtgtcaaagggtggaaagattgtagaactaaacattaacgtnnnnnnnnn-taaactatcgttgatataaa |
118 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
7423910 |
tgagtcatagcattttgccacataggcgtgtgtcaaagggtggaaagattgtagaactaaacattaacgtaaaaaataaataaacaatcgttgatataaa |
7423811 |
T |
 |
| Q |
119 |
tctaaaattatacca------atatatatatcaggagccaaagtataaatttattacaaaacactaggtacagcatgtac |
192 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7423810 |
tctaaaattataccatataatatatatatatcaggagccaaagtataaatttattacaaaacactaggtacagcatgtac |
7423731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University