View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16624_low_10 (Length: 396)
Name: NF16624_low_10
Description: NF16624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16624_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 331; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 35 - 373
Target Start/End: Original strand, 40657017 - 40657355
Alignment:
| Q |
35 |
cacagatatccttaccttacttggtgttggctcaggtatatcagatgagtggcagatgggagagcgcggttcgagtgaggaaggctatggaaaatagagg |
134 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40657017 |
cacaaatatccttaccttacttggtgttggctcaggtatatcagatgagtggcagatgggagagcgcggttcgagtgaggaaggctatggaaaatagagg |
40657116 |
T |
 |
| Q |
135 |
tagtaaagagttcataggatgcagttgggttggcataaaaaaccatgtatatacttttgaatcaaatcaattacagcattatggtggcaaagatatttat |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40657117 |
tagtaaagagttcataggatgcagttgggttggcataaaaaaccatgtatatacttttgaatcaaatcaattacagcattatggtggcaaagatatttat |
40657216 |
T |
 |
| Q |
235 |
ctgctgctgaatttgctggtatgggagatggagacagaatgtggtgtctaaatattgtatagcagtttgtggggaatatggatggtgaattgaagcgggg |
334 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40657217 |
ctgctgctgaatttgctggtatgggagatggagacagaatgtggtgtctaaatattgtatagcagtttgtggggaatatggatggtgaattgaagtgggg |
40657316 |
T |
 |
| Q |
335 |
ttacaatttacaaactctgattgtgatatgtgaaagtta |
373 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40657317 |
ttacaatttacaaactctgattgtgatatgtgaaagtta |
40657355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 158; Significance: 6e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 6e-84
Query Start/End: Original strand, 183 - 368
Target Start/End: Original strand, 56533899 - 56534083
Alignment:
| Q |
183 |
atatacttttgaatcaaatcaattacagcattatggtggcaaagatatttatctgctgctgaatttgctggtatgggagatggagacagaatgtggtgtc |
282 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
56533899 |
atatacttttgaatcaaatcaattacatcattatggtggcaaagatatttatctgctgctgaatttgctggtatgggaaatggagacagaatgtggtgtc |
56533998 |
T |
 |
| Q |
283 |
taaatattgtatagcagtttgtggggaatatggatggtgaattgaagcggggttacaatttacaaactctgattgtgatatgtgaa |
368 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
56533999 |
taaatattgtatagcagttggtggggaatatggatggtgaattgaag-tgggttacaatttacaaactctgattgtgatttgtgaa |
56534083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University