View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16624_low_12 (Length: 371)
Name: NF16624_low_12
Description: NF16624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16624_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 369; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 369; E-Value: 0
Query Start/End: Original strand, 1 - 369
Target Start/End: Complemental strand, 46893835 - 46893467
Alignment:
| Q |
1 |
tacaattctccaacactctctctttgaggcgtttacacaagtatttgctaagcagtatccaagacaagcacaagtgaatgctgttggaccgtttggtatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46893835 |
tacaattctccaacactctctctttgaggcgtttacacaagtatttgctaagcagtatccaagacaagcacaagtgaatgctgttggaccgtttggtatg |
46893736 |
T |
|
| Q |
101 |
tgttttgattccaaaaggattaaccaagctcttagtgttgagtttgtgatggataggcctgatgttgtttggagaatctctggtgaaaacttgatggtgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46893735 |
tgttttgattccaaaaggattaaccaagctcttagtgttgagtttgtgatggataggcctgatgttgtttggagaatctctggtgaaaacttgatggtgc |
46893636 |
T |
|
| Q |
201 |
agccacgaaatggggtttcttgtttggcatttgtgaatggtgggttgcatcctaaagctgctattactattggaagtcgtcaattggaagaaaatatgat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46893635 |
agccacgaaatggggtttcttgtttggcatttgtgaatggtgggttgcatcctaaagctgctattactattggaagtcgtcaattggaagaaaatatgat |
46893536 |
T |
|
| Q |
301 |
gatgtttgatcttgcaaggtcaaggcttgggtttactaattccttgaactcccatggaatgaagtgttc |
369 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46893535 |
gatgtttgatcttgcaaggtcaaggcttgggtttactaattccttgaactcccatggaatgaagtgttc |
46893467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 172 - 257
Target Start/End: Complemental strand, 3063874 - 3063789
Alignment:
| Q |
172 |
gagaatctctggtgaaaacttgatggtgcagccacgaaatggggtttcttgtttggcatttgtgaatggtgggttgcatcctaaag |
257 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |||| | |||||||||||| ||| ||| ||||| ||||| || |||||| |
|
|
| T |
3063874 |
gagaatctatggtgaaaacttgatggtgcagccatataatgagatttcttgtttgggattcgtggatggttggttgtattctaaag |
3063789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University