View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16624_low_15 (Length: 313)

Name: NF16624_low_15
Description: NF16624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16624_low_15
NF16624_low_15
[»] chr3 (2 HSPs)
chr3 (193-295)||(42524921-42525023)
chr3 (13-88)||(42524741-42524816)
[»] chr5 (1 HSPs)
chr5 (196-271)||(29282648-29282723)
[»] chr8 (1 HSPs)
chr8 (196-271)||(6470269-6470344)


Alignment Details
Target: chr3 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 193 - 295
Target Start/End: Original strand, 42524921 - 42525023
Alignment:
193 gtgctggttcaggttctggttgtggaactattttggcttgctttttagttcgtctataaacaaaatccactaacttgttgccgtccatggtccccgtcac 292  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42524921 gtgctggttcaggttctggttgtggaactattttggcttgctttttagttcgtctataaacaaaatccactaacttgttgccgtccatggtccccgtcac 42525020  T
293 aat 295  Q
    |||    
42525021 aat 42525023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 13 - 88
Target Start/End: Original strand, 42524741 - 42524816
Alignment:
13 gattatactagttatagtacaccatcctcttcatcatatcttcctcatcatgaactccattaatctcttccccatc 88  Q
    ||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42524741 gattataatagttatagtacatcatcctcttcatcatatcttcctcatcatgaactccattaatctcttccccatc 42524816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 196 - 271
Target Start/End: Complemental strand, 29282723 - 29282648
Alignment:
196 ctggttcaggttctggttgtggaactattttggcttgctttttagttcgtctataaacaaaatccactaacttgtt 271  Q
    ||||||||||||| ||||  ||||||||||| ||||| ||||| |||| |||||| ||| ||||||||| ||||||    
29282723 ctggttcaggttcgggtttaggaactattttcgcttgttttttggttcttctatagacataatccactagcttgtt 29282648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 196 - 271
Target Start/End: Original strand, 6470269 - 6470344
Alignment:
196 ctggttcaggttctggttgtggaactattttggcttgctttttagttcgtctataaacaaaatccactaacttgtt 271  Q
    ||||||||||||||||||  ||||||||||| ||||| ||||| |||  | |||| ||| ||||||||| ||||||    
6470269 ctggttcaggttctggtttaggaactatttttgcttgttttttggtttttttatagacataatccactagcttgtt 6470344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University