View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16624_low_20 (Length: 254)
Name: NF16624_low_20
Description: NF16624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16624_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 187
Target Start/End: Original strand, 5901647 - 5901834
Alignment:
| Q |
1 |
ctattgtgaagtgtgtgttgttgttatttatttagggtttgtgaaaa-gttgaaaagagtgaagaaggagggaagaaagtgtggttgtgaaaggcgggat |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5901647 |
ctattgtgaagtgtgtgttgttgttatttatttagggtttgtgaaaaagttgaaaagagtgaagaaggagggaagaaagtgtggttgtgaaaggcgggat |
5901746 |
T |
|
| Q |
100 |
gaggtttatttttggggtttggtttgaaatttattgactgttttggcggaaactacaaaacagaacgttgcttaccgcgcggagttac |
187 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5901747 |
gaggtttttttttggggtttggtttgaaatttattgactgttttggcggaaactgcaaaacagaacgttgcttaccgcgcggagttac |
5901834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 207 - 244
Target Start/End: Original strand, 5901882 - 5901919
Alignment:
| Q |
207 |
gactgattcaccactatctttttcaattgtgagaataa |
244 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
5901882 |
gactgattcatcactatctttttcaattgtgaaaataa |
5901919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University