View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16624_low_21 (Length: 252)
Name: NF16624_low_21
Description: NF16624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16624_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 85; Significance: 1e-40; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 116 - 235
Target Start/End: Complemental strand, 22369331 - 22369211
Alignment:
| Q |
116 |
acagttattagttaattgctttctattatgtgaagtaagcgcacacatcttttgcacacttt-tnnnnnnnnttgtagtttctgattattgaatttttta |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
22369331 |
acagttattagttaattgctttctattatgtgaagtaagcgcacacatcttttgcacactttaaaaaaaaaattgtagtttctgattattgaatttttta |
22369232 |
T |
 |
| Q |
215 |
aaatctgcaagtttatgtttg |
235 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
22369231 |
aaatctgcaagtttatgtttg |
22369211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 31 - 83
Target Start/End: Complemental strand, 22369416 - 22369364
Alignment:
| Q |
31 |
agatatccttcatatcattttcaatatagtcaaaggtatcggttagtactcca |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
22369416 |
agatatccttcatatcattttcaatatagtcaaagatatcggttagtactcca |
22369364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 198 - 226
Target Start/End: Original strand, 40798150 - 40798178
Alignment:
| Q |
198 |
gattattgaattttttaaaatctgcaagt |
226 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
40798150 |
gattattgaattttttaaaatctgcaagt |
40798178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University