View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16624_low_23 (Length: 230)
Name: NF16624_low_23
Description: NF16624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16624_low_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 48 - 116
Target Start/End: Original strand, 17959970 - 17960038
Alignment:
| Q |
48 |
ccagcaaaagggctgttttcaaaatatctcaatttcccaactcacatcacaatgttcaagtttattagc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17959970 |
ccagcaaaagggctgttttcaaaatatctcaatttcccaactcacatcacaatgttcaagtttattagc |
17960038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University