View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16625_high_10 (Length: 244)
Name: NF16625_high_10
Description: NF16625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16625_high_10 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 68 - 244
Target Start/End: Complemental strand, 25706357 - 25706181
Alignment:
| Q |
68 |
catgttgtattcctcaaatttcatcaccaagtagcccttgtgtttgcttatgggactaccattcacttcatatatttttgagaggttagtgacctctttt |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
25706357 |
catgttgtattcctcaaatttcatcaccaagtagcccttgtgtttgcttatgggatttccattcacttcatatatttttgagaggttagagacccctttt |
25706258 |
T |
 |
| Q |
168 |
gacaacatgctaactaatgactcccattggtttctgcccactgaatcacctgcaaacacaatgcgtccattgcgact |
244 |
Q |
| |
|
|| | ||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25706257 |
gatagcatgcaaagtaatgactcccattggtttctgcccactgaatcacctgcaaacacaatgcgtccattgcgact |
25706181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 68 - 101
Target Start/End: Complemental strand, 9711828 - 9711795
Alignment:
| Q |
68 |
catgttgtattcctcaaatttcatcaccaagtag |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
9711828 |
catgttgtattcctcaaatttcatcaccaagtag |
9711795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University