View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16625_low_11 (Length: 265)
Name: NF16625_low_11
Description: NF16625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16625_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 7 - 249
Target Start/End: Original strand, 12847674 - 12847916
Alignment:
| Q |
7 |
tgagatgaaatgcaaggcctgcaagaactaattatatcatttgtctaattataagctgaacaaccatcactaacgatacaaaactaataagaaagggaaa |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
12847674 |
tgagatgaaatgcaaggcctgcaagaactaattatatcattagtctaattataagctgaacaaccatcactaacgatacaaaactaataagaaagggaca |
12847773 |
T |
|
| Q |
107 |
aagaagagaagccatgaacaagcttttcaatatttggcatataaggaccatagaacatccacgagatccaatgtcacttctcaaagatcatcataacaac |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
12847774 |
aagaagagaagccatgaacaagcttttcaatatttggcatataaggaccatagaacatccacgagatccaatgtcacttcccaaagatcatcataacaac |
12847873 |
T |
|
| Q |
207 |
ttaattacagttcagagaattgcagatggtggaaaatggtagg |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12847874 |
ttaattacagttcagagaattgcagatggtggaaaatggtagg |
12847916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University