View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16625_low_15 (Length: 238)
Name: NF16625_low_15
Description: NF16625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16625_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 89 - 216
Target Start/End: Complemental strand, 55067484 - 55067357
Alignment:
| Q |
89 |
cagcagtgctaaatggtgcgatgattttttcgcacacgaaaaagcagcttaacgtgcaaactcattacttagggctatattttattaaaaataacataaa |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
55067484 |
cagcagtgctaaatggtgcgatgattttttcgcacacgaaaaagcagcttaacgtgcaaactcattacttagggctatattttattaaaaataaaataaa |
55067385 |
T |
 |
| Q |
189 |
aatgctcaaaatataatatttccattat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
55067384 |
aatgctcaaaatataatatttccattat |
55067357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 122 - 179
Target Start/End: Original strand, 30330674 - 30330731
Alignment:
| Q |
122 |
acacgaaaaagcagcttaacgtgcaaactcattacttagggctatattttattaaaaa |
179 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||| ||| || || |||| |||||||| |
|
|
| T |
30330674 |
acacgaataagtagcttaacgtgcaaactcattatttaaggttaaatttcattaaaaa |
30330731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University