View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16625_low_5 (Length: 410)
Name: NF16625_low_5
Description: NF16625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16625_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 101 - 374
Target Start/End: Original strand, 12869914 - 12870182
Alignment:
| Q |
101 |
atgtagcaacattgaaggaattgttaaaatctaaatatggggaaggggagcctactatggttaacattaatcgaacaaggccggtcaagtttgtttcttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12869914 |
atgtagcaacattgaaggaattgttaaaatctaaatatggggaaggggagcctactatggttaacattaatcgaacaaggccggtcaagtttgtttcttt |
12870013 |
T |
|
| Q |
201 |
atggcggaaagatatttgtgatttagatagataaagtgagggagtcgaacctagattggtttcttgaatatgcaaagaagaaaatagggaatggtgtcgc |
300 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12870014 |
atggcggaaagatatttgtgatt----tagataaagtgagggagtcgaacctagattggtttcttgaatatgcaaagaagaaaatagggaatggtgtcgc |
12870109 |
T |
|
| Q |
301 |
tacannnnnnnngcgtgagccttggctttcaatttaccgctttgcaacgcttttccttatactttttcctatgc |
374 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |||||||||| || |||||||||||||| |
|
|
| T |
12870110 |
tacattttttttgcgtgagccttggctttcaatttaccgctttgtgacgcttttcc-tagactttttcctatgc |
12870182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University