View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16626_high_26 (Length: 232)
Name: NF16626_high_26
Description: NF16626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16626_high_26 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 26156232 - 26155989
Alignment:
| Q |
1 |
actatagcttagtctagtcagatttttggacttttatgattcgtttataacacggacaaatatttgattccaaaaacgaccttaaaagtc-------tca |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||| |
|
|
| T |
26156232 |
actatagcttagtctagtcagatttttggacttttttgattcgtttataacacggacaaatatttgattccaaaaaccaccttaaaagtccaccgtctca |
26156133 |
T |
 |
| Q |
94 |
ctctcaccaatatcttaagtagttaaggtagtttggttcacctaaatttatgatcctgttcatattatgtatgttaacatgttatgttatg-----ttat |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
26156132 |
ctctcaccaatatcttaagtagttaaggtagtttggttcacctaaatttatgatcctgttcatattatgtatgttaacatgttatgttatgttatgttat |
26156033 |
T |
 |
| Q |
189 |
actattttcctaagagtatctccaatactagggtttttaataaa |
232 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
26156032 |
actattttcctaagagtatctccagtactagggtttttaataaa |
26155989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University