View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16626_high_30 (Length: 222)
Name: NF16626_high_30
Description: NF16626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16626_high_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 18 - 139
Target Start/End: Original strand, 31477793 - 31477927
Alignment:
| Q |
18 |
ccaattatccttaggccttcataaattagcaaagtagattatgaagaatcaagctagta-------------agaaaatgattatcaagcctcgtgattt |
104 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31477793 |
ccaattattcttaggccttcataaattagcaaagtagattatgaagaatcaagctagtagcaaggcttgagaagaaaatgattatcaagcctcgtgattt |
31477892 |
T |
 |
| Q |
105 |
tagttttgttccaagttaagatgtttgtagaatct |
139 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31477893 |
tagttttgttccaagttaagatgttagtagaatct |
31477927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 136 - 207
Target Start/End: Original strand, 31478464 - 31478532
Alignment:
| Q |
136 |
atctacaagcttttgatgcaacaaccaccttgtatttcccctatttctttgtcctactctctatctctctct |
207 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31478464 |
atctacaagcttttgatgcaac---caccttgtatttcccctatttctttgtcctactctctatctctctct |
31478532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 84 - 139
Target Start/End: Original strand, 14196599 - 14196654
Alignment:
| Q |
84 |
gattatcaagcctcgtgattttagttttgttccaagttaagatgtttgtagaatct |
139 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
14196599 |
gattatcaagccccgtgattttagttttgttccaatttaagatgtttgtagaatct |
14196654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 91 - 139
Target Start/End: Original strand, 43041116 - 43041163
Alignment:
| Q |
91 |
aagcctcgtgattttagttttgttccaagttaagatgtttgtagaatct |
139 |
Q |
| |
|
||||||||||||||||| |||||||||| |||||||||| ||||||||| |
|
|
| T |
43041116 |
aagcctcgtgattttag-tttgttccaatttaagatgttagtagaatct |
43041163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 91 - 139
Target Start/End: Complemental strand, 37748052 - 37748004
Alignment:
| Q |
91 |
aagcctcgtgattttagttttgttccaagttaagatgtttgtagaatct |
139 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
37748052 |
aagcctcgtgattttagttttgttccaatttaagatgttagtagaatct |
37748004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University