View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16626_low_30 (Length: 222)
Name: NF16626_low_30
Description: NF16626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16626_low_30 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 16 - 208
Target Start/End: Original strand, 16461658 - 16461863
Alignment:
| Q |
16 |
acacaaacactagacgcgacacttacacgttgacgccagtaataatttaataaaatggcaaaatttaatgtaatcatgtgtgttggt------------- |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
16461658 |
acacaaacactagacgcgacacttacacgttgacgccagtaataatttaataaaatggcaaaatttaatgtaatcacgtgtgttggtggtgtcagtgtcg |
16461757 |
T |
 |
| Q |
103 |
ggtgttagtgtcggacacgtggcacgcctacgacaaatgaggctgcattgagtgcttttgaccacgttcctctttaatatcaaatatcacaaactgcaac |
202 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16461758 |
ggtgtcagtgtcggacacgtggcacgcctatgacgaatgaggctgcattgagtgcttttgaccacgttcctctttaatatcaaatatcacaaactgcaac |
16461857 |
T |
 |
| Q |
203 |
ctttgc |
208 |
Q |
| |
|
| |||| |
|
|
| T |
16461858 |
cgttgc |
16461863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 56 - 103
Target Start/End: Original strand, 23607926 - 23607973
Alignment:
| Q |
56 |
aataatttaataaaatggcaaaatttaatgtaatcatgtgtgttggtg |
103 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||| |||||||| |||| |
|
|
| T |
23607926 |
aataatttaataaaatgacaaaattgaatgtaataatgtgtgtcggtg |
23607973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 58 - 116
Target Start/End: Original strand, 1916765 - 1916825
Alignment:
| Q |
58 |
taatttaataaaatggcaaaatttaatgtaatcatgtgtgttggtg--gtgttagtgtcgg |
116 |
Q |
| |
|
|||||||| ||| || |||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
1916765 |
taatttaagaaattgacaaaatttaatgtaatcacatgtgttggtgtcgtgttagtgtcgg |
1916825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 67 - 103
Target Start/End: Complemental strand, 2648580 - 2648544
Alignment:
| Q |
67 |
aaaatggcaaaatttaatgtaatcatgtgtgttggtg |
103 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
2648580 |
aaaatgacaaaatttaatgtaatcatatgtgttggtg |
2648544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University