View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16627_high_14 (Length: 272)
Name: NF16627_high_14
Description: NF16627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16627_high_14 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 114; Significance: 7e-58; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 90 - 272
Target Start/End: Original strand, 40740360 - 40740542
Alignment:
| Q |
90 |
tggtggtagagttgcgcacttgcattatggatgtcatgggttcaactccaacaactattctaaattaattttttgctttaattannnnnnncaacatgat |
189 |
Q |
| |
|
||||||| |||| || | ||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
40740360 |
tggtggtggagtagcacgcttgcattatggatgtcatggattcaactccaacaactattctaaattaaatttttgctttaattatttttttcaacatgat |
40740459 |
T |
 |
| Q |
190 |
tgtgcctctcttaagcctaatttttcgtggatttgagttttaaatatcctcaatgctatctttttccttaaaaacaaaacata |
272 |
Q |
| |
|
|| ||||| |||||||||||||| || |||||||||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
40740460 |
tgggcctcacttaagcctaatttatcatggatttgagttttaaatatcctcaatgttttctttttccttaaaaacaaaacata |
40740542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 204 - 268
Target Start/End: Complemental strand, 36102066 - 36102002
Alignment:
| Q |
204 |
gcctaatttttcgtggatttgagttttaaatatcctcaatgctatctttttccttaaaaacaaaa |
268 |
Q |
| |
|
||||||||| || |||||||||||| |||||||| | ||| || ||||||| ||||||||||||| |
|
|
| T |
36102066 |
gcctaatttatcatggatttgagttctaaatatctttaatactctcttttttcttaaaaacaaaa |
36102002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 219 - 265
Target Start/End: Complemental strand, 21416887 - 21416841
Alignment:
| Q |
219 |
gatttgagttttaaatatcctcaatgctatctttttccttaaaaaca |
265 |
Q |
| |
|
|||||||||| ||||||| |||||| || |||||||||||||||||| |
|
|
| T |
21416887 |
gatttgagttctaaatattctcaatactctctttttccttaaaaaca |
21416841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University