View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16627_low_12 (Length: 378)
Name: NF16627_low_12
Description: NF16627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16627_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 5 - 371
Target Start/End: Original strand, 401743 - 402111
Alignment:
| Q |
5 |
acagatatgaaactgaatataggacatcacagccctctcccattccagcacaacagccacatcccatagccataggcgctatattggcaagacttcagag |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
401743 |
acagatatgaaactgaatataggacatcacagccctctcccattccagcacaacagccacatcccatagccataggcgctatattggcaagacttcagag |
401842 |
T |
|
| Q |
105 |
gtttgttccacctgaaagggttcgaagattgagacctataatgtttcgttgaatgaaatctccgaaaaccagcaaatatttattctggcatctcataaat |
204 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
401843 |
gtttgttccatctgaaagggttcgaagattgagacctataatgtttcgttgaatgaaatctccgaaaaccagcaaatatttattctggcatctcataaat |
401942 |
T |
|
| Q |
205 |
acaatctcgattttattcccagttaaaccagccggcttcaagcaattgagagagnnnnnnnnggtcttccaacacccttcaaacacagaaaccaattgtt |
304 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
401943 |
acaatctcgattttatccacagttaaaccagccggcttcaagcaattgagagagttttttttggtcttccaacacccttcaaacacagaaaccaattgtt |
402042 |
T |
|
| Q |
305 |
tgggttagcagcctcccagcacaccat--cacacacacaaagtccccatcttgcatccgcttcatctca |
371 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
402043 |
tgggttagcagcctcccagcacaccatcacacacacacaaagttcccatcttgcatcagcttcatctca |
402111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University