View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16627_low_14 (Length: 322)
Name: NF16627_low_14
Description: NF16627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16627_low_14 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 112 - 322
Target Start/End: Original strand, 47907094 - 47907304
Alignment:
| Q |
112 |
tcattacatcatatattttgtgtttatctctttccaaactaaatactaaaactggagcaatgccaatctaaaatgacctaacctgatatttcatatcgaa |
211 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
47907094 |
tcattacatcatatattttgtgtttatctttttccaaactaaatactaaaactggagcaatgccaatctaaaatgacctaacctggtatttcatatcgaa |
47907193 |
T |
|
| Q |
212 |
aataatgcgttaaattttacataacacttgctagtttataagaaaaaattgaagacgtcggttattttggtttgtttgttgtaaatagatgacttcatgt |
311 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47907194 |
aataatgcgttaaattttgcagaacacttgctagtttataagaaaaaattgaagacattggttattttggtttgtttgttgtaaatagatgacttcatgt |
47907293 |
T |
|
| Q |
312 |
gggaagtgttt |
322 |
Q |
| |
|
||||||||||| |
|
|
| T |
47907294 |
gggaagtgttt |
47907304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University