View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16627_low_24 (Length: 249)
Name: NF16627_low_24
Description: NF16627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16627_low_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 47 - 239
Target Start/End: Original strand, 32423322 - 32423514
Alignment:
| Q |
47 |
taagcttacaatacaaaacttgctataaatgaatatcttaccatgtttacattttatttgcctaacgaaaaatgaaacaatatcattaggcatgattttg |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32423322 |
taagcttacaatacaaaacttgctataaatgaatatcttaccatgtttacattttatttgcctaacgaaaaatgaaacagtatcattaggcatgattttg |
32423421 |
T |
 |
| Q |
147 |
aaaatgtagatggataattacacactcatacatatatgtattattatagatacacattactaattttcagttgatttttctgcaattggttct |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32423422 |
aaaatgtagatggataattacacactcatacatatatgtattattatagatacatattactaattttcagttgatttttctgcaattggttct |
32423514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 50 - 171
Target Start/End: Original strand, 32430416 - 32430537
Alignment:
| Q |
50 |
gcttacaatacaaaacttgctataaatgaatatcttaccatgttt-acattttatttgcctaacgaaaaatgaaacaatatcattaggcatgattttgaa |
148 |
Q |
| |
|
||||||||| |||| || |||||||||||||||||| |||||||| |||||| |||||||||| |||||| || ||||||||||||||||| |||| ||| |
|
|
| T |
32430416 |
gcttacaattcaaacctggctataaatgaatatcttgccatgttttacattt-atttgcctaatgaaaaaagatacaatatcattaggcataatttggaa |
32430514 |
T |
 |
| Q |
149 |
aatgtagatggataattacacac |
171 |
Q |
| |
|
|| || ||| |||||||||||| |
|
|
| T |
32430515 |
aagatatatgaataattacacac |
32430537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University