View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16628_high_1 (Length: 616)
Name: NF16628_high_1
Description: NF16628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16628_high_1 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 16 - 269
Target Start/End: Complemental strand, 3078440 - 3078189
Alignment:
| Q |
16 |
acaaagcaatatggttcgaatagagaattttgctttggaaggaggtcctaataaagaaatatatggttcaaatgtttgtggtttgttggaaggaggaatc |
115 |
Q |
| |
|
||||||||||||||||||||||||||| | |||||||||||||||| |||||| |||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3078440 |
acaaagcaatatggttcgaatagagaaatatgctttggaaggaggttctaatagagaaatat--ggttcgaatgtttgtggtttgttggaaggaggaatc |
3078343 |
T |
|
| Q |
116 |
gcgagttgcccatcgaattcctcaagatggtggaaggatttagttagtattgaaggaagagatgggtcgtattggtttaatgaagaggttgctagaaagg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3078342 |
gcgagttgcccatcgaattcctcaagatggtggaaggatttagttagtattgaaggaagagatgggtcgtattggtttaataaagaggttgctagaaagg |
3078243 |
T |
|
| Q |
216 |
tgagaaatggggctcataccaagttttgggatgccaagtggagagggggtgttc |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3078242 |
tgagaaatggggctcataccaagttttgggatgcgaagtggagagggggtgttc |
3078189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 105; E-Value: 4e-52
Query Start/End: Original strand, 270 - 439
Target Start/End: Complemental strand, 3077716 - 3077552
Alignment:
| Q |
270 |
gagttgtttaagtgggttgattactcgtttattatgcttcaaaatgtctttaatcattgggcgtgttggaacgtggggaggttttaacaagaaggtggtt |
369 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |||||| |
|
|
| T |
3077716 |
gagttgtttaagtgggtcaattactcgtttattatgcttcaaaatgtctttaatcattgggcgtgttggaacg-ctggaggtttt----agaaagtggtt |
3077622 |
T |
|
| Q |
370 |
aagggtcttaggctcattcggcattcaactatttgggtgatttagaaggcgaggaatgaaaagattttta |
439 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||| || ||||| ||||||||||||||||| |
|
|
| T |
3077621 |
aagggtcttaggctcatttggcatgcaactatttgggtgatttggacggcgaagaatgaaaagattttta |
3077552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University