View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16628_low_13 (Length: 320)
Name: NF16628_low_13
Description: NF16628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16628_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 22 - 303
Target Start/End: Complemental strand, 11401649 - 11401368
Alignment:
| Q |
22 |
tttcttacaagtaaagataaaacaaacggtgctccttatcttcaagtggtccagtagtatcatcatttcttaatggtgaagacttgtcttctagaatgct |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
11401649 |
tttcttacaagtaaagataaaacaaacggtgctccttatcttcaagtggtccagtagtatcatcatttcttaatggtgaagacttgtcttctggaatgct |
11401550 |
T |
 |
| Q |
122 |
tctaaaatcttctagtttatgcttgatttaattttcttacagttgtcatttgtcattgttgatattgtttgtgtgacctgtcttgacataatattttgca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | |
|
|
| T |
11401549 |
tctaaaatcttctagtttatgcttgatttaattttcttacggttgtcatttgtcattgtttatattgtttgtgtgacctgtcttgacataatattttaaa |
11401450 |
T |
 |
| Q |
222 |
attaactgaaatttcttttgcacacgttggtgttgactaattgtgtatttcataaaattccatcagaacatcaaggtttctt |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
11401449 |
attaactgaaatttcttttgcacacgttggtgttgactaattgtgtatttcataaaattccatcaaagcatcaaggtttctt |
11401368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University