View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16628_low_18 (Length: 244)
Name: NF16628_low_18
Description: NF16628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16628_low_18 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 17 - 244
Target Start/End: Complemental strand, 2152502 - 2152275
Alignment:
| Q |
17 |
aagtttctatttatgtacatatttatttgattgtcttgttattttctcaaactgcactaaacctcttggtaactagtaaatgtttggttgcatttaagat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2152502 |
aagtttctatttatgtacatatttatttgattgtctttttattttctcaaactgcaccaaacctcttggtaactagtaaatgtttggttgcatttaagat |
2152403 |
T |
|
| Q |
117 |
ttcattannnnnnngctacatattgtcttttaataatataatagtcatttaatttgttaaaaggattcttatatactcttcaaagaaatttattttgatt |
216 |
Q |
| |
|
||||||| | || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2152402 |
ttcattatttttttgttatatattgtcttttaataatataatagtcatttaatttgttaaaaggattcttatatactcttcaaagaaatttattttgatt |
2152303 |
T |
|
| Q |
217 |
ttagtaaattagtttgttagtttattct |
244 |
Q |
| |
|
||||||||||||||||||||||| |||| |
|
|
| T |
2152302 |
ttagtaaattagtttgttagttttttct |
2152275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University