View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16628_low_19 (Length: 239)
Name: NF16628_low_19
Description: NF16628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16628_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 19 - 229
Target Start/End: Original strand, 47870256 - 47870466
Alignment:
| Q |
19 |
ccaatctcatttaattacgaaggctttaaatatgatgatgtgaagctagaaggagatgcttctttgttggattcatacattcaacttacttcaacctcaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47870256 |
ccaatctcatttaattacgaaggctttaaatatgatgatgtgaagctagaaggagatgcttctttgttggattcatacattcaacttacttcaacctcaa |
47870355 |
T |
 |
| Q |
119 |
ggtaccaaagcaacgctttcagtgttggtcgagtcacgtttttcgagccattgcaactatgggacaagacctcaagaaaaatcaccgatttcactactaa |
218 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
47870356 |
ggtaccaaagcaatgctttcagtgttgggcgagtcacgtttttcgagccattgcaactatgggacaagacctcaagaaaaatcactgatttcactactaa |
47870455 |
T |
 |
| Q |
219 |
attttcctttg |
229 |
Q |
| |
|
||||||||||| |
|
|
| T |
47870456 |
attttcctttg |
47870466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 18 - 229
Target Start/End: Complemental strand, 47875275 - 47875061
Alignment:
| Q |
18 |
accaatctcatttaattacgaa---ggctttaaatatgatgatgtgaagctagaaggagatgcttctttgttggattcatacattcaacttacttcaacc |
114 |
Q |
| |
|
|||| |||||||||||||| || ||||||||||||||| ||||||| ||||||||||||||||||||| | |||||| ||| ||||| ||||||||| |
|
|
| T |
47875275 |
accactctcatttaattaccaacagggctttaaatatgataatgtgaaactagaaggagatgcttctttgctttattcatccatccaactgacttcaacc |
47875176 |
T |
 |
| Q |
115 |
tcaaggtaccaaagcaacgctttcagtgttggtcgagtcacgtttttcgagccattgcaactatgggacaagacctcaagaaaaatcaccgatttcacta |
214 |
Q |
| |
|
||||| ||| || | | ||| ||||||||| |||| || | ||| |||||||||||||||||||| ||||||||||||||| |||| |||||||||| |
|
|
| T |
47875175 |
tcaagttacgaagacgaaacttacagtgttgggagagtgacatgttttgagccattgcaactatgggaaaagacctcaagaaaactcactgatttcacta |
47875076 |
T |
 |
| Q |
215 |
ctaaattttcctttg |
229 |
Q |
| |
|
| |||||||||||| |
|
|
| T |
47875075 |
cccaattttcctttg |
47875061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University