View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16628_low_25 (Length: 211)

Name: NF16628_low_25
Description: NF16628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16628_low_25
NF16628_low_25
[»] chr8 (1 HSPs)
chr8 (11-187)||(16607303-16607479)


Alignment Details
Target: chr8 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 11 - 187
Target Start/End: Original strand, 16607303 - 16607479
Alignment:
11 gaagaatatcaagagacttggatcgttgaaagaaatcaattgctccattggaannnnnnngtatattgtaattagtgtatgatcgtcacatgtaaataag 110  Q
    ||||||| ||| |||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||  ||||||||||||||||    
16607303 gaagaatttcaggagacttggatcgttgaaagaaatcaattgctccattggaatttttttgtatattgtaattagtgtatga--gtcacatgtaaataag 16607400  T
111 aggtatgagattttgtatggaccatattcttcgatgaaattagtctcaaatatgt--tagtagatatatgaactaaagg 187  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||    
16607401 aggtatgagattttgtatggaccatattcttcgatgaaattagtctcaaatatgttatagtagatatatgaactaaagg 16607479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University