View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16629_high_40 (Length: 287)
Name: NF16629_high_40
Description: NF16629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16629_high_40 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 119; Significance: 8e-61; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 12 - 134
Target Start/End: Complemental strand, 60979 - 60857
Alignment:
| Q |
12 |
acagacgacatataagataaggggtgtaggaacgagaaatataaaataaaagatgtgaagttgaagagtgtttaggcccattaagttgggctgggcttat |
111 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
60979 |
acagacaacatataagataaggggtgtaggaacgagaaatataaaataaaagatgtgaagttgaagagtgtttaggcccattaagttgggctgggcttat |
60880 |
T |
 |
| Q |
112 |
atatggaaaagtgagtgagtctt |
134 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
60879 |
atatggaaaagtgagtgagtctt |
60857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 202 - 269
Target Start/End: Complemental strand, 60789 - 60722
Alignment:
| Q |
202 |
tggcgttgcattggttggaagctatgttacctttgggaataattgctggaatgctttgtgttatgggt |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
60789 |
tggcgttgcattggttggaagctatgttacctttgggaataattgctggaatgctttgcgttatgggt |
60722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University