View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16629_high_45 (Length: 269)
Name: NF16629_high_45
Description: NF16629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16629_high_45 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 14 - 253
Target Start/End: Original strand, 39333594 - 39333833
Alignment:
| Q |
14 |
gaagagagttatgcagaatgaagatacctgtgtccaagtcagcgacatcaatgaatatgtcccatgccccatgaccatgcaaagtggcagtctcttctat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39333594 |
gaagagagttatgcagaatgaagatacctgtgtccaagtcagcgacatcaatgaatatgtcccatgccccatgaccatgcaaagtggcagtctcttctat |
39333693 |
T |
|
| Q |
114 |
agagcttctgcatatccattatacacttggttggtaatttatttatatagatcccagcagagtcgtggnnnnnnngtctataccagagggctcatgacat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39333694 |
agagcttctgcatatccattatacacttggttggtaatttatttatatagatcccagcagagtcgtggtttttttgtctataccagagggctcatgacat |
39333793 |
T |
|
| Q |
214 |
gtgaaagaactgcattagtattaagtataaggaaaatgtt |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39333794 |
gtgaaagaactgcattagtattaagtataaggaaaatgtt |
39333833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 52; Significance: 7e-21; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 118 - 214
Target Start/End: Complemental strand, 12928904 - 12928808
Alignment:
| Q |
118 |
cttctgcatatccattatacacttggttggtaatttatttatatagatcccagcagagtcgtggnnnnnnngtctataccagagggctcatgacatg |
214 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||||| |||||| ||||||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
12928904 |
cttctacatatccattatccacttggttggtaatttatttatacagatccaagcagagtcatggttttctggtctataccagtgggctcatgacatg |
12928808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 118 - 214
Target Start/End: Complemental strand, 12938182 - 12938085
Alignment:
| Q |
118 |
cttctgcatatccattatac-acttggttggtaatttatttatatagatcccagcagagtcgtggnnnnnnngtctataccagagggctcatgacatg |
214 |
Q |
| |
|
||||| |||||||||||| | ||||||||||||||||||||||| |||||| ||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
12938182 |
cttctacatatccattatcccacttggttggtaatttatttatacagatccaagcagagtcatggttttttggtctataccagagggctcatgacatg |
12938085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University