View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16629_high_56 (Length: 249)
Name: NF16629_high_56
Description: NF16629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16629_high_56 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 11343341 - 11343109
Alignment:
| Q |
1 |
agtaataagatatagannnnnnncaagcttataaaaggattttatggatagttttttactttggtatacaaatagatactcataaatattcctaccattc |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11343341 |
agtaataagatatagatttttttcaagcttataaaaggattttatggatagttttttactttggtatacaaatagatactcataaatattcctaccattc |
11343242 |
T |
|
| Q |
101 |
cacttgtttgtaaaatctgaagaaggggaatccaacaaaacatgccacttcaaaaacggaacatcattttgttggaatttgaagtaccatgaatagcagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11343241 |
cacttgtttgtaaaatctgaagaaggggaatccaacaaaacatgccacttcaaaaatggaacatcattttgttggaatttgaagtaccatgaatagcagc |
11343142 |
T |
|
| Q |
201 |
tctcatcaatcaccaacatcactggcttcactg |
233 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
11343141 |
tctcatcaatcactaacatcactggcttcactg |
11343109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University