View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16629_high_69 (Length: 211)
Name: NF16629_high_69
Description: NF16629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16629_high_69 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 171 - 211
Target Start/End: Original strand, 22250935 - 22250975
Alignment:
| Q |
171 |
acaagcagcactgaaatttttgatgataaaacctcacatgc |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22250935 |
acaagcagcactgaaatttttgatgataaaacctcacatgc |
22250975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University