View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16629_low_30 (Length: 360)
Name: NF16629_low_30
Description: NF16629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16629_low_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 59; Significance: 6e-25; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 159 - 225
Target Start/End: Original strand, 14193740 - 14193806
Alignment:
| Q |
159 |
tgaggttatttgaattttccaagttgttgattgactttgtggttttatttctctgtttgcaaattgt |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
14193740 |
tgaggttatttgaattttccaagttgttgattgaccttatggttttatttctctgtttgcaaattgt |
14193806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 56 - 122
Target Start/End: Original strand, 14193669 - 14193735
Alignment:
| Q |
56 |
ttaaacagggatatttcaattctctttactttctgttggatgaaaagcttatgcaggtggtgaagat |
122 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
14193669 |
ttaaacagggatatttcaattctgtttactttctgttggatggaaagcttatgcaggtgttgaagat |
14193735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 254 - 304
Target Start/End: Original strand, 14193877 - 14193927
Alignment:
| Q |
254 |
attggtttgttgtgtgaaagattttctagatcattgattcgttgtttttcc |
304 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
14193877 |
attggtttgttgtgtgaaagattttctatatcattgattcgctgtttttcc |
14193927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University