View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16629_low_35 (Length: 329)
Name: NF16629_low_35
Description: NF16629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16629_low_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 1 - 314
Target Start/End: Complemental strand, 41264162 - 41263849
Alignment:
| Q |
1 |
tatccagatgtttcaactgatggtgtgtggtgctacattgtattgtgggttattccacaatctatattgcttcctaggatgagttattcttatctgaaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41264162 |
tatccagatgtttcaactgatggtgtgtggtgctacattgtattgtgggttattccacaatctatattgcttcctaggatgagttattcttatctgaaag |
41264063 |
T |
 |
| Q |
101 |
accgtcttcaggcaatttgtcccccctgtgtagcctcgttttatcacgtccagaaacccaccacatcttctcctgtttatctactgaaattctgttgcct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41264062 |
accgtcttcaggcaatttgtcccccctgtgtagcctcgttttatctcgtccagaaacccaccacatcttctcctgtttatctactgaaattctgttgcct |
41263963 |
T |
 |
| Q |
201 |
cgatcgaaaggggttattacacggtaatcaaaatatcttcactcaaagtgatcttccatatgcatattttcgacactttcatctgtaattgtgatgctaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41263962 |
cgatcgaaaggggttattacacggtaatcaaaatatcttcactcaaagtgatcttccatatgcatattttcgacactttcatctataattgtgatgctaa |
41263863 |
T |
 |
| Q |
301 |
tactgttcattgat |
314 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
41263862 |
tactgttcattgat |
41263849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University