View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16629_low_41 (Length: 287)
Name: NF16629_low_41
Description: NF16629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16629_low_41 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 14 - 267
Target Start/End: Complemental strand, 31726985 - 31726732
Alignment:
| Q |
14 |
agattgtgatcccatcaccatccgatctttctttcctaacacgatggcaatgaagaaatgttgttggtcttcaatctcttacaaggaagtacacttgatg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31726985 |
agattgtgatcccatcaccatccgatctttctttcctaacacgatggcaatgaagaaatgttgttggtcttcaatctcttacaaggaagtacacttgatg |
31726886 |
T |
 |
| Q |
114 |
atttttaacataataatgattacaacccaattccatatagttgagatcattatagaaggtgaaggagannnnnnnnnnnnnnnccttctagaaaaataat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
31726885 |
atttttaacataataatgattacaacccaattccatatagttgagatcattatagaaggtgaaggagatatatatattttttttcttctagaaaaataat |
31726786 |
T |
 |
| Q |
214 |
gatttcttagtggtgatgatgagttgagatgattattgttgtttagagggataa |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31726785 |
gatttcttagtggtgatgatgagttgagatgattattgttgtttagagggataa |
31726732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 16 - 60
Target Start/End: Complemental strand, 39082346 - 39082302
Alignment:
| Q |
16 |
attgtgatcccatcaccatccgatctttctttcctaacacgatgg |
60 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39082346 |
attgtaatcccatcaccatccgatctttctttcctaacacgatgg |
39082302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 59 - 97
Target Start/End: Complemental strand, 34523012 - 34522974
Alignment:
| Q |
59 |
ggcaatgaagaaatgttgttggtcttcaatctcttacaa |
97 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
34523012 |
ggcaatgaagaaatgttattagtcttcaatctcttacaa |
34522974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University