View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16629_low_54 (Length: 253)
Name: NF16629_low_54
Description: NF16629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16629_low_54 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 2189201 - 2188990
Alignment:
| Q |
1 |
ttgtagtgatttaggatattgttcacagtctgagcatcctaataagtgttttgcaaatcatcaaactatcatctacaaagaagagacgagtaattcttgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2189201 |
ttgtagtgatttaggatattgttcacagtctgagcatcctaataagtgttttgcaaatcattaaactatcatctacaaagaagagacgagtaattcttgt |
2189102 |
T |
|
| Q |
101 |
ggggctcctacagcaatttgaataccatggaggttacaattttcttgagatttccatatttatcctgaaattacttctgtatatatgataaacatgtaag |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2189101 |
ggggctcctacaacaatttgaataccatggaggttacaactttcttgagatttccatatttatcctaaaattacttctgtatatatgataaacatgtaat |
2189002 |
T |
|
| Q |
201 |
gagatagcgagt |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
2189001 |
gagatagcgagt |
2188990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 215 - 249
Target Start/End: Complemental strand, 2188795 - 2188761
Alignment:
| Q |
215 |
ccacaccacacccctttgtacccttcttttctctc |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
2188795 |
ccacaccacacccctttgtacccttcttttttctc |
2188761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University