View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16629_low_71 (Length: 214)
Name: NF16629_low_71
Description: NF16629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16629_low_71 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 51; Significance: 2e-20; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 54 - 108
Target Start/End: Complemental strand, 24820194 - 24820140
Alignment:
| Q |
54 |
attcacgttcaatttccaagatgataattttagtaaagaaaatggaaccaagact |
108 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24820194 |
attcatgttcaatttccaagatgataattttagtaaagaaaatggaaccaagact |
24820140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 169 - 208
Target Start/End: Complemental strand, 24820079 - 24820040
Alignment:
| Q |
169 |
ggagaattagtgaagaaaatcatgttgaaagtataatcta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24820079 |
ggagaattagtgaagaaaatcatgttgaaagtataatcta |
24820040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 22 - 54
Target Start/End: Complemental strand, 24820281 - 24820249
Alignment:
| Q |
22 |
gactttactcattttaaaagaaaattagtagta |
54 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
24820281 |
gactttactcattttaaaagaaaattagtagta |
24820249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University