View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16629_low_74 (Length: 209)

Name: NF16629_low_74
Description: NF16629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16629_low_74
NF16629_low_74
[»] chr6 (1 HSPs)
chr6 (17-155)||(9059721-9059859)


Alignment Details
Target: chr6 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 17 - 155
Target Start/End: Original strand, 9059721 - 9059859
Alignment:
17 aaaattacaatgggctgattagatacatatttaaatttaaataagcaaagtaccactgacaagtggtatgaatttttcatctatatgataatgacaaatt 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9059721 aaaattacaatgggctgattagatacatatttaaatttaaataagcaaagtaccactgacaagtggtatgaatttttcatctatatgataatgacaaatt 9059820  T
117 ttctaaccaagtgatatcttgaactaaaatagtaaatgg 155  Q
    |||||||||||||||||||||||||||||||||||||||    
9059821 ttctaaccaagtgatatcttgaactaaaatagtaaatgg 9059859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University