View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16630_high_10 (Length: 306)
Name: NF16630_high_10
Description: NF16630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16630_high_10 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 20 - 306
Target Start/End: Original strand, 30300628 - 30300914
Alignment:
| Q |
20 |
cgatatatagagatccagtcagtagtcaactttgtttatgtttttatccttaacgtaatattttgattgagtgataagtaattccctcttataatgcttt |
119 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30300628 |
cgatatatagagatccagtgagtagtcaactttgtttatgtttttatccttaacgtaatattttgattgagtgataagtaattccctcttataatgcttt |
30300727 |
T |
 |
| Q |
120 |
tttccgtgtttaagttgtaaatgacaaaatgattctcttttgttagattcttgtgatattcaaaatcaaattctgtattcttatatgatgatttcacttt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30300728 |
tttccgtgtttaagttgtaaatgacaaaatgattctcttttgttagattcttgtgatattcaaaatcaaattctgtattcttatatgatgatttcacttt |
30300827 |
T |
 |
| Q |
220 |
tggagcagtcaattgattctggagaagtacaattgattttgactttaccactagaattgattctaacttgtatgttggttctgtgtt |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30300828 |
tggagcagtcaattgattctggagaagtacaattgattttgactttaccactagaattgattctaacttgtatgttggttctgtgtt |
30300914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University