View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16630_high_14 (Length: 253)
Name: NF16630_high_14
Description: NF16630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16630_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 9 - 224
Target Start/End: Complemental strand, 30300362 - 30300147
Alignment:
| Q |
9 |
gatatgaagaacgacgacggcgggaactacttttcggagagattttcgccagtcttcggcagttgcggcgttttcctgaaacggtggatcaatttccatg |
108 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30300362 |
gatacgaagaacgacgacggcgggaactactttgcggagagattttcgccagtcttcggcagttgcggcgttttcctgaaacggtggatcaatttccatg |
30300263 |
T |
 |
| Q |
109 |
gataagtcgtcggttttaacggcggcgatggagtcaattccgtccgatcctaaccgctccgatggatcttccattgaatgagattagggtttaattgagt |
208 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30300262 |
gataagtcgtcggttttcacggcggcgatggagtcaattccgtccgatcctaaccgctccgatggatcttccattgaatgagattagggtttaattgagt |
30300163 |
T |
 |
| Q |
209 |
taaggatgtgatgtga |
224 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
30300162 |
taaggatgtgaagtga |
30300147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University