View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16630_high_15 (Length: 253)
Name: NF16630_high_15
Description: NF16630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16630_high_15 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 14 - 238
Target Start/End: Original strand, 34849396 - 34849620
Alignment:
| Q |
14 |
aggttggtagtggcaagacaaacaaaacagttgatccaaataacagctcaaaaagcaagtcaggtgattcagtttgtagacatgatcatgaagttgagaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34849396 |
aggttggtagtggcaagacaaacaaaacagttgatccaaataacagttctaaaagcaagtcaggagattcagtttgtagacatgatcatgaagttgagaa |
34849495 |
T |
|
| Q |
114 |
agatgcaactttgtcactactaataaactcacttcaacaacaaaccaaatcagatgattatgatatgcaaaaaattgaagatgattctgaagaagcagaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34849496 |
agatgcaactttgtcactactaataaactcacttcaacaacaaaccaaatcagatgattatgatatgcaaaaaattgaagatgattctgaagaagcagaa |
34849595 |
T |
|
| Q |
214 |
cataaagatgttccagattggctac |
238 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
34849596 |
cataaagatgttccagattggctac |
34849620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University