View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16630_high_18 (Length: 231)

Name: NF16630_high_18
Description: NF16630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16630_high_18
NF16630_high_18
[»] chr2 (2 HSPs)
chr2 (40-98)||(18514184-18514243)
chr2 (191-228)||(18514277-18514314)


Alignment Details
Target: chr2 (Bit Score: 44; Significance: 3e-16; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 40 - 98
Target Start/End: Original strand, 18514184 - 18514243
Alignment:
40 tatcaattaggttggtttggcccaaagggttatgctttcataatgtt-gcgaactaaagt 98  Q
    |||||||||||||||||||||| |||||||||| ||||||||||||| ||||||||||||    
18514184 tatcaattaggttggtttggccgaaagggttatactttcataatgttagcgaactaaagt 18514243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 191 - 228
Target Start/End: Original strand, 18514277 - 18514314
Alignment:
191 aaattgactattcttctttagtgagatttcttttttaa 228  Q
    ||||||||||||||||||||||||||||||||||||||    
18514277 aaattgactattcttctttagtgagatttcttttttaa 18514314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University