View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16630_low_2 (Length: 653)
Name: NF16630_low_2
Description: NF16630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16630_low_2 |
 | |
|
| [»] scaffold0208 (4 HSPs) |
| | |
|
Alignment Details
Target: scaffold0208 (Bit Score: 106; Significance: 1e-52; HSPs: 4)
Name: scaffold0208
Description:
Target: scaffold0208; HSP #1
Raw Score: 106; E-Value: 1e-52
Query Start/End: Original strand, 36 - 214
Target Start/End: Original strand, 3405 - 3579
Alignment:
| Q |
36 |
cacacacctcttccttctccctagttcagtttatattttctatttgcttgcatcgatctttgcatcaattggatggttgaagaatatctcataacatctg |
135 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| | ||| ||| ||||||||||||| |||||||||||| |||||||||| ||| |
|
|
| T |
3405 |
cacacgcctcttccttctccctagttcagtttatattttctatcttgttgtatc----tttgcatcaattgaatggttgaagaagatctcataaccgctg |
3500 |
T |
|
| Q |
136 |
gaatgaagctttagctgcattgaacatttgttcataaataacaatccagtttttgcctctttcaatggatcaacttaga |
214 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3501 |
gaataaagctttagcagcattgaacatttgttcataaataaggatctagtttttgcctctttcaatggatcaacttaga |
3579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0208; HSP #2
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 306 - 372
Target Start/End: Original strand, 3789 - 3855
Alignment:
| Q |
306 |
ttttgagatcgtgatgtgtatatcaagaataattcaaccaattcttaaggaatgaataaatttgtaa |
372 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
3789 |
ttttgagatcatgatgtgtatattaagaataattcaacgaattcttaagaaatgaataaatttgtaa |
3855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0208; HSP #3
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 435 - 617
Target Start/End: Original strand, 13295 - 13484
Alignment:
| Q |
435 |
ctagctctacttgtacttttccatctccacttgtgaagtaaata------tgtgaccctg-ccagatttatggatgtaaacggacaacagaagcccgttc |
527 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| ||| ||||||||| |||||||||| |||||||| || |||| || | | | |
|
|
| T |
13295 |
ctagctctacttgaacttttccatctccacttgtgaagtggatacaggcttgtgaccctcaccagatttatagatgtaaatgg-caactaaattcattcc |
13393 |
T |
|
| Q |
528 |
ttt-gaaccaattcttgcaaaagattcttgtataaaacatgatctcgtcctaaaatttggacaatcatatgggtgtaaaaaacactaaaca |
617 |
Q |
| |
|
||| ||||||||||| |||| |||| ||||||| | || ||| | |||||||||||| ||||||||||||| ||||||||||| |||||| |
|
|
| T |
13394 |
ttttgaaccaattctcacaaacgatttttgtatataccacgattttgtcctaaaatttagacaatcatatggatgtaaaaaacaataaaca |
13484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0208; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 371 - 418
Target Start/End: Original strand, 5956 - 6003
Alignment:
| Q |
371 |
aacaaaattataagatgaaccaatcaaggaaagtgaaactcacctaca |
418 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| ||||||||| |
|
|
| T |
5956 |
aacaaaattataagatgaactgatcatggaaagtgaaaatcacctaca |
6003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University