View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16630_low_24 (Length: 320)
Name: NF16630_low_24
Description: NF16630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16630_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 14 - 247
Target Start/End: Original strand, 45615885 - 45616122
Alignment:
| Q |
14 |
agaacctgtggctactctttatttatgccgctctggaatttgaactaatagaa--gattataaaccataagtagggtccatctaagaatatagctaggtt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||| | |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
45615885 |
agaacctgtggctactctttatttatgccgctctggaatttggactaatagcacagattataagccataagtagggtccatctaagaatatagctaggtt |
45615984 |
T |
 |
| Q |
112 |
caaagtaggataccagcttgcccttttagaaatagaattttggaaaagaaatcatta-agaaaatgggtggttaagacatcagtcaaaaataaaata-tt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| |||||||| |||||||||||||||| ||| || |
|
|
| T |
45615985 |
caaagtaggataccagcttgcccttttagaaatagaatttttgaaaagaaatcattagagaaaatggttggttaagtcatcagtcaaaaataagatactt |
45616084 |
T |
 |
| Q |
210 |
aaatcatagactaaacaataagagtaattagtaggcac |
247 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45616085 |
aaatcatagactaaacattaagagtaattagtaggcac |
45616122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University