View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16630_low_28 (Length: 303)
Name: NF16630_low_28
Description: NF16630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16630_low_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 86; Significance: 4e-41; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 4 - 109
Target Start/End: Complemental strand, 36938404 - 36938300
Alignment:
| Q |
4 |
tgcatcatttcgtcaacctttaaataattaatgtaattaaaaatttgctacatccaactataaaaaagatttctataaactacaatgtcatgataatggt |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
36938404 |
tgcatcatttcgtcaacctttaaataattaatgtaatgaaaaatttgc-acatccaactataaaaaagatttctatagactataatgtcatgataatggt |
36938306 |
T |
 |
| Q |
104 |
atgtca |
109 |
Q |
| |
|
|||||| |
|
|
| T |
36938305 |
atgtca |
36938300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University