View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16630_low_37 (Length: 256)
Name: NF16630_low_37
Description: NF16630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16630_low_37 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 92 - 250
Target Start/End: Original strand, 25619615 - 25619773
Alignment:
| Q |
92 |
aatattgagagagtgatggtgaactagatctgaaagttcaagtaactatagctcaaaggtttcatctttcaatcaaagggtcattcatcaaatgctttaa |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25619615 |
aatattgagagagtgatggtgaactagatctgaaagttcaagtaactatagctcaaaggtttcatctttcaatcaaagggtcattcatcaaatgctttaa |
25619714 |
T |
|
| Q |
192 |
ggctttggttttggttttgattttctcagtgtcagaaaatgccttctccttcatctcac |
250 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
25619715 |
ggctttggttttggttttgattttctgggtgtcagaaaatgccttctccttcatttcac |
25619773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University