View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16630_low_41 (Length: 246)
Name: NF16630_low_41
Description: NF16630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16630_low_41 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 18 - 229
Target Start/End: Complemental strand, 17776280 - 17776069
Alignment:
| Q |
18 |
atttcttgctgccatttgtaagcaggtaaggaacaaacaataagcgagtaaatagtcaagttggtccttaaaactgtacggttgtattaacctagtctcc |
117 |
Q |
| |
|
|||||||||||| || || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17776280 |
atttcttgctgcaatatgcaagcaggtaaggaacaaacaataagcgagtaaatagtcaagttggtccttaaaactgtacggttgtattaacctagtctcc |
17776181 |
T |
|
| Q |
118 |
cacattatcgactttctaaattgatccctgaaattgcaaaatgttaatcaattttatccctttatctagatctgttatcaaatgcattcttgacactatg |
217 |
Q |
| |
|
|| ||||||||||||||||||| |||| |||||||||||||||||||||| ||| |||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
17776180 |
catgttatcgactttctaaattgttccccgaaattgcaaaatgttaatcaaatttgtccctttatctatatctgttatcaaatgcattcttgacactatg |
17776081 |
T |
|
| Q |
218 |
cactcagtttca |
229 |
Q |
| |
|
|||||||||||| |
|
|
| T |
17776080 |
cactcagtttca |
17776069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 148 - 200
Target Start/End: Complemental strand, 41050052 - 41050000
Alignment:
| Q |
148 |
aaattgcaaaatgttaatcaattttatccctttatctagatctgttatcaaat |
200 |
Q |
| |
|
||||||||||||| ||||||| || |||| | |||||||| |||||||||||| |
|
|
| T |
41050052 |
aaattgcaaaatggtaatcaacttcatccatctatctagagctgttatcaaat |
41050000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 139 - 167
Target Start/End: Original strand, 21496432 - 21496460
Alignment:
| Q |
139 |
tgatccctgaaattgcaaaatgttaatca |
167 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
21496432 |
tgatccctgaaattgcaaaatgttaatca |
21496460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University