View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16630_low_42 (Length: 245)
Name: NF16630_low_42
Description: NF16630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16630_low_42 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 16 - 229
Target Start/End: Complemental strand, 7077115 - 7076898
Alignment:
| Q |
16 |
aaaagtgcatctataaacaaaacaaaaatgagtttttaacat-gaatctcttatgaattttattcatacagnnnnnnncttcttctgttattcatatgta |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| | |||||| |||||||||||||| |
|
|
| T |
7077115 |
aaaagtgcatctataaacaaaacaaaaatgagtttttaacatagaatctcttatgaattttattcatacggatttttttttcttccgttattcatatgta |
7077016 |
T |
|
| Q |
115 |
atattaatataaatatctttcataccgtaattttaactactagat---aaaagatgttttgttttaatcgtagttgtgtatacaattataaatattaata |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7077015 |
atattaatataaatatctttcataccgtaattttaactactagatcataaaagatgttttgttttaatcgtagttgtgtatgcaattataaatattaata |
7076916 |
T |
|
| Q |
212 |
attgtgatttataaacat |
229 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
7076915 |
attgtgatttataaacat |
7076898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University